There were only a few G categories until 2008 when major revisions to categories were made. Article Use the Previous and Next buttons to navigate the slides or the slide controller buttons at the end to navigate through each slide. Moreover, the accuracy and validity of the evolutionary rate has been independently confirmed in several deep-rooted Hutterite pedigrees.34 Furthermore pedigree rate-based estimates cannot be substantiated, as they are often inconsistent with dateable archeological knowledge, for example, as clearly illustrated regarding the peopling of the Americas.35 Coalescent times based on 10 STR loci (DYS19, DYS388, DYS389I, DYS389b, DYS390, DYS391, DYS392, DYS393, DYS439, DYS461-TAGA counts) and the median haplotypes of specific hg G sub-haplogroups are presented in Supplementary Table S4. L223 is found on the Y chromosome at rs810801 and 6405148 with a mutation from C to G. L223 was first identified in samples at 23andMe in 2009 but proved problematic as an individual test, the first successful results being reported at Family Tree DNA in late 2011 under its assigned L223 label. (2000) suggested 17,000 years ago. Differential Y-chromosome Anatolian influences on the Greek and Cretan Neolithic. Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. P287 was identified at the University of Arizona and became widely known in late 2007. This is not surprising, as clines are not expected in cases of sharp changes in haplogroup frequency over a relatively small distance such as those observed for hg G, for instance between the Caucasus and Eastern Europe. Kivisild T, Rootsi S, Metspalu M et al. The origin of haplogroup G is controversial. Ancient DNA from European early neolithic farmers reveals their near eastern affinities. In Lebanon, however, G accounts for 6.5% of the population and in Iran to around 10%. Nonetheless, coalescent times provide a valuable/informative relative metric for estimating the time of lineage formation. Lacan M, Keyser C, Ricaut FX et al. Kharkov VN, Stepanov VA, Borinskaya SA et al. Mitochondrial haplogroup N is a "Macro-haplogroup", also called a "Superhaplogroup." All humans who left Africa descended from mtDNA haplogroup L3, and that ancient lineage soon gave rise to two great daughter families, M and N, which, in turn, became the mothers of billions. Haplogroup G1 is a primary subclade of haplogroup G . Although compared with G1-M285, the phylogenetic level of P303 (Figure 1) is shallower but its geographic spread zone covers the whole hg G distribution area (Figure 2b). Evaluation of Y-chromosomal STRs: a multicenter study. The 12f2a mutation, which characterizes haplogroup J, was observed in 445 subjects. Bosch E, Calafell F, Comas D, Oefner PJ, Underhill PA, Bertranpetit J : High-resolution analysis of human Y-chromosome variation shows a sharp discontinuity and limited gene flow between northwestern Africa and the Iberian Peninsula. In the Near/Middle East, the highest P303 frequency is detected among Palestinians (17.8%), whereas in Europe the frequency does not exceed 6%. Included within G-L91 are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not L91+. Phylogenetic relationships of studied binary markers within haplogroup G in wider context of M89-defined clade. L1771.1/ L177_1, L1771.2/L177_2, L177.3/L177_3) was withdrawn as an identifier by ISOGG in 2013, after it was "found to be an unreliable palindromic snp". Am J Hum Genet 2008; 82: 236250. The emergence of Y-chromosome haplogroup J1e among Arabic-speaking populations. Various estimated dates and locations have been proposed for the origin of G-M201, most of them in Western Asia. (a) Principal component analysis by population. Chiaroni J, King RJ, Myres NM et al. First, we calculated haplogroup diversity using data in Supplementary Table S1 for the 52 instances when total population sample size exceeded 50 individuals and 5hg G chromosomes were observed. Haplogroup K2b1 (P397/P399) is also known as Haplogroup MS, but has a broader and more complex internal structure. Hum Hered 2006; 61: 132143. It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. Unresolved G2a-P15* lineages occur across a wide area extending from the Near/Middle East to the Balkans and Western Europe in the west, the Caucasus (especially the South Caucasus) in the north and Pakistan in the east. Finally, to the east, G2a3a-M406 has an expansion time of 8800 years ago in Iran, a time horizon that corresponds to the first Neolithic settlements of the Zagros Mountains of Iran. G2a3a-M406 has a modest presence in Thessaly and the Peloponnese (4%),10 areas of the initial Greek Neolithic settlements. Almost all L141 men belong to L141 subclades. The corresponding coalescent estimate for M377 is 5600 years ago (Supplementary Table S4). Two sources of the Russian patrilineal heritage in their Eurasian context. Eur J Hum Genet 2010; 18: 463470. Although both broadly distributed, G2a-P15* and its downstream L91 sub-lineage have low frequencies, with the exception of Sardinia and Corsica. The fragments were run on the ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems). While neither knowledge of paleo-climate, archeology or genetic evidence from a single locus using modern populations provides an unimpeachable microcosm of pre-historical expansions, considering them together cautiously provides a contextual framework for discussion. Haplogroup K2a (M2308) and its primary subclade K-M2313 were separated from Haplogroup NO (F549) in 2016. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa. Haplogroup G (M201) is a human Y-chromosome haplogroup. The M201 SNP mutation that characterizes haplogroup G was identified at Stanford University and was first reported in 2001. Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus. The hg G individuals in Supplementary Table S1 were either first genotyped for this study or updated to present phylogenetic resolution from earlier studies.2, 4, 10, 11, 13, 16, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 All hg G (M201-derived) samples were genotyped in a hierarchical manner for the following binary markers: M285, P20, P287, P15, L91 P16, M286, P303, U1, L497, M406, Page19, M287 and M377. Correspondence to In addition, we introduce five new markers: M426, M461, M485, M527 and M547 (Supplementary Table S2). Nat Commun 2012; 3. de Knijff P, Kayser M, Caglia A et al. (2004) suggested the mutation took place only 9,500 years ago. P15 was identified at the University of Arizona and became widely known by 2002. Geographic spread patterns of the P303-derived groups defined by L497, U1 and P15(xP303)-derived P16 and M406 lineages, all of which achieve a peak frequency of at least 10%, are presented in Figures 2bf, respectively. In the Tirol (Tyrol) of western Austria, the percentage of G-M201 can reach 40% or more; perhaps the most famous example is the ancient remains of the so-called "Iceman", tzi. Parallel evolution of genes and languages in the Caucasus region. [7], (Subclades here conform to the Y-DNA SNP definitions used by ISOGG In 2012, several categories found only in one man in research studies were removed from the ISOGG tree causing some renaming. The 96 populations were collapsed into 50 regionally defined populations by excluding populations where the total G count was less than n=5. BMC Evol Biol 2011; 11: 69. Eur J Hum Genet 2009; 17: 820830. Spatial autocorrelation analysis was carried out to assess the presence/absence of clines regarding informative G sub-haplogroups. It is not found among Native Americans except where intermarriage with non-native persons has occurred. Gurdeep Matharu Lall, Maarten H. D. Larmuseau, Mark A. Jobling, Hovhannes Sahakyan, Ashot Margaryan, Richard Villems, Javier Rodriguez Luis, Leire Palencia-Madrid, Rene J. Herrera, Sandra Oliveira, Alexander Hbner, Jorge Rocha, Alessandra Modi, Desislava Nesheva, David Caramelli, Maxat Zhabagin, Zhaxylyk Sabitov, Elena Balanovska, Veronika Csky, Dniel Gerber, Anna Szcsnyi-Nagy, European Journal of Human Genetics In 2012, SNPs with the Z designation as first identified by citizen researchers from 1000 Genomes Project data began to appear. Until 2008, new G SNPs were reported from labs at the University of Arizona (P designations), Stanford University (M designations) or the University of Central Florida (U designations). Because M201 was identified first, it is the standard SNP test used when testing for G persons. RV thanks the European Union Regional Development Fund for support through the Centre of Excellence in Genomics, the Estonian Ministry of Education and Research for the Basic Research grant SF 0270177As08. The M527-defined sub-clade is unusual in that it reflects the presence of hg G-U1 that is otherwise rare in Europe. Int J Legal Med 1997; 110: 141149. the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in First, the G2a1-P16 lineage is effectively Caucasus specific and accounts for about one-third of the Caucasian male gene pool (Figure 2f). A network analysis of representative hg G-P16 Y-STR haplotypes reveals a diffuse cluster (Supplementary Figure S2). Pichler I, Fuchsberger C, Platzer C et al. In human genetics, Haplogroup G-P303 ( G2a2b2a, [2] formerly G2a3b1) is a Y-chromosome haplogroup. Sengupta S, Zhivotovsky LA, King R et al. The British samples have inconsistent double values for STR marker DYS19 in many cases. . Hammer MF, Behar DM, Karafet TM et al. The highest reported concentration of G1 and its subclades in a single country is in Iran, with next most frequent concentrations in neighboring countries to the west. We attempted to localize the potential geographic origin of haplogroup G-M201 by considering those locations containing both G1-M285- and G2-P287-related lineages as well as the co-occurrence of high sub-haplogroup diversity. ASD0 is the average squared difference in the number of repeats between all current chromosomes of a sample and the founder haplotype, which is estimated as the median of current haplotypes. The hg G-U1 subclade is characterized by several sub-clusters of haplotypes, including a more diverse cluster mostly represented by Caucasus populations. In Egypt, studies have provided information that pegs the G percentage there to be between 2% and 9%. Internet Explorer). (2004) Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the . Although not exceeding 3% frequency overall, haplogroup G1-M285 reflects a branching event that is phylogenetically equivalent to the more widespread companion G2-P287 branch in the sense that both branches coalesce directly to the root of G-M201. The discovery of new SNPs can result in assignment of new names to haplogroup categories. The genome-wide structure of the Jewish people. The mutations involved may be complicated and difficult to interpret. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa . If a sample meets the criteria indicated for these three markers, it is likely the sample is G2a2b1. Semino et al. Nasidze I, Quinque D, Dupanloup I et al. This is likely due to a local founder effect.[40]. [42] The technical specifications of M201 are given as: refSNPid is rs2032636..Y chromosome location of 13536923.forward primer is tatgcatttgttgagtatatgtc..reverse primer is gttctgaatgaaagttcaaacg..the mutation involves a change from G to T. A number of SNPs have been identified with seemingly the same coverage in the population as M201. Such temporal estimates must be viewed with caution owing to differences in individual STR locus mutation rates, sensitivity to rare outlier STR alleles and complexities related to multiple potential founders during a demographic event. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. Specifically, we intersected these criteria by applying the following filters. The L91 mutation is found at 21327383 and rs35474563 on the Y-chromosome. Although the present-day frequency of G1 is low across its spread zone, the expansion time estimate (Supplementary Table S4) of 192716158 years attests to considerable antiquity. Elizabeth T Wood, Daryn A Stover, Christopher Ehret, L177, later discarded in favour of PF3359 and equivalent SNPs, was first identified at. Its estimated Td of 120953000 years ago suggests considerable antiquity allowing time to accumulate STR diversity and also to disperse relatively widely. Network of 248 samples P303 derived from Supplementary Table S3. The Caucasus as an asymmetric semipermeable barrier to ancient human migrations. In addition, there are multiple other SNPs thought to have the same coverage as M201. This group was created for the folks who's paternal Y-DNA reflects they belong to haplogroup G2a (G-P15). Almost all haplogroup G1 persons have the value of 12 at short tandem repeat (STR) marker DYS392 and all will have the M285 or M342 SNP mutation which characterizes this group. These Neolithic European were descendants of Neolithic farmers from Anatolia, among some of the earliest peoples in the world to practice agriculture. The next largest subclade of G-P303 is characterized by the presence of the U1 mutation. Parent Branch: G-FGC5081 Descendant branch(s): G-Z17084 G-Z45043 FTDNA Tree Link: Link YFull Info. Although the phylogenetic resolution within hg G has progressed,1, 17 a comprehensive survey of the geographic distribution patterns of significant hg G sub-clades has not been conducted. In the Greek island of Crete, approximately 7%[18] to 11%[19] of males belong to haplogroup G. Genetic evidence concerning the origins of South and North Ossetians. Thus, G2a3a-M406, along with other lineages, such as J2a3b1-M92 and J2a4h2-DYS445=616, may track the expansion of the Neolithic from Central/Mediterranean Anatolia to Greece/Italy and Iran. Y chromosome genetic variation in the Italian peninsula is clinal and supports an admixture model for the Mesolithic-Neolithic encounter. [16] The concentration of G falls below this average in Scandinavia, the westernmost former Soviet republics and Poland, as well as in Iceland and the British Isles. In 2009-10, Family Tree DNA's Walk through the Y Project, sequencing certain Y-chromosome segments, provided a number of new G SNPs with the L designation. Haplogroup G ( M201) is a human Y-chromosome haplogroup. Reduced genetic structure of the Iberian peninsula revealed by Y-chromosome analysis: implications for population demography. The G2 clade consists of one widespread but relatively infrequent collection of P287*, M377, M286 and M287 chromosomes versus a more abundant assemblage consisting of G2a-related P15*, P16 and M485-related lineages. This skeleton could not be dated by radiocarbon dating, but other skeletons there were dated to between 5,100 and 6,100 years old. Y chromosome sequence variation and the history of human populations. Another notable feature is its uneven distribution. suggested that: "We estimate that the geographic origin of haplogroup G plausibly locates somewhere nearby eastern Anatolia, Armenia or western Iran. This group has been linked with the Crypto-Jewish population which fled to the island during the time of the Spanish Inquisition, of which a significant portion are identifiable as G-Z725 (DYS388=13). The Network 4.6.0.0 (Fluxus-Engineering) program was used (median-joining algorithm and the post-processing option). The double 19 value situation is not seen in the G2a1 and G2a3 subclades. Hg G is most common in the Caucasus with a maximum frequency exceeding 70% in North Ossetians,2, 3 decreasing to 13% in Iran4 and then rapidly dissipating further eastward. Am J Hum Genet 2003; 72: 313332. PLoS One 2011; 6: e17548. In Europe west of the Black Sea, Haplogroup G is found at about 5% of the population on average throughout most of the continent. A majority of members of G-P303 belong to one of its subclades, rather than to G-P303*, The largest G-P303* subclade based on available samples is one in which almost all persons have the value of 13 at STR marker DYS388. You are using a browser version with limited support for CSS. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters. Croat Med J 2005; 46: 502513. The second component, influenced by the relatively high presence of M377, separates Ashkenazi Jews from other populations (Figure 3a). Int J Legal Med 1997; 110: 134149. Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ : Y-chromosome diversity characterizes the Gulf of Oman. G2a was found also in 20 out of 22 samples of ancient Y-DNA from Treilles, the type-site of a Late Neolithic group of farmers in the South of France, dated to about 5000 years ago. (a)(f) Spatial frequency maps of haplogroup G (hg G) and its sub-clades with frequencies over 10%. More distantly, G2a3a-M406 occurs in Italy (3%) with a Td of 8100 years ago, consistent with the model of maritime Neolithic colonization of the Italian peninsula from coastal Anatolia and/or the Levant. [44] The "U" SNPs were identified in 2006 but not published until 2009.[45]. The Y-chromosomal haplogroup G (hg G) is currently defined as one of the 20 standard haplogroups comprising the global Y-chromosome phylogeny.1 The phylogeographic demarcation zone of hg G is largely restricted to populations of the Caucasus and the Near/Middle East and southern Europe. Am J Hum Genet 2004; 74: 5061. Y-DNA haplogroups are useful to determine whether two apparently unrelated individuals sharing the same surname do indeed descend from a common ancestor in a not too distant past (3 to 20 generations). Conversely, hg G is present in Northeast Caucasus only at an average frequency of 5% (range 019%). The South Ossetians and Svans generally south of North Ossetia have significant number of G2a1 persons, but population percentages have not yet been provided. Eur J Hum Genet 2007; 15: 485493. The expansion time of G-M406 in Anatolia is 12800 years ago, which corresponds to climatic improvement at the beginning of the Holocene and the commencement of sedentary hunter-forager settlements at locations, such as Gobekli Tepi in Southeast Anatolia, thought to be critical for the domestication of crops (wheat and barley) that propelled the development of the Neolithic. (Previously the name Haplogroup S was assigned to K2b1a4. Y-chromosomal diversity in Lebanon is structured by recent historical events. Mol Biol Evol 2011; 28: 29052920. volume20,pages 12751282 (2012)Cite this article. Mitochondrial DNA and Y Chromosome Variation Provides Evidence for a Recent Common Ancestry between Native Americans and Indigenous Altaians. The L293 SNP that characterizes a third subclade was identified in June 2010 at Family Tree DNA. (Behar et al., 2012b) Origin Most researchers consider the birthplace of G to have been born in East Asia. Lacan M, Keyser C, Ricaut FX et al. In other words, these mutations are so unique that they could only come from other cells with the same mutations. Origin. MH and MHS are thankful to the National Institute for Genetic Engineering and Biotechnology, Tehran, Iran, and the National Research Institute for Science policy, Tehran, Iran, for providing the samples. This value of 12 is uncommon in other G categories other than G1. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. Proc Natl Acad Sci USA 2011; 108: 1825518259. Haplogroup L2b1a is a branch on the maternal tree of human kind. The members of G-PF3359 are probably smaller in number than men included in G-P303, but only a small amount of testing has occurred for the relevant mutations. [citation needed] For this are several indications. In Russia, Ukraine and Central Asia, members of various ethnic minorities and/or residents in particular localities possess G-M201 at its highest levels in the world even though the average rate at the national level is about 1% or less. Genomics 1999; 57: 433437. Eur J Hum Genet 2010; 18: 348353. Am J Hum Genet 2000; 67: 15261543. A clade of closely related Ashkenazi Jews represent virtually all G2b persons, with just three other G2b haplotypes having been reported so far: one Turk from Kars in northeast Turkey near Armenia, one Pashtun, and one Burusho in Pakistan. The Iceman belongs to haplogroup G2a2b [13] (earlier called G2a4). The frequency data were converted into isofrequency maps using the Surfer software (version 8, Golden Software, Inc., Golden, CO, USA), following the kriging algorithm using advanced options to use bodies of waters as breaklines. Science 2000; 290: 11551159. The second common hg G lineage in the Caucasus is U1, which has its highest frequencies in the South (22.8% in Abkhazians) and NW Caucasus (about 39.7% in Adyghe and 36.5% in Cherkessians), but also reaches the Near/Middle East with the highest frequency in Palestinians (16.7%) and, shows extremely low frequency in Eastern Europe. The presence of the SNP P18 mutation characterizes G2a1a's only subclade, G2a1a. We performed principal component analysis to determine the affinities of various hg G fractions with respect to total M201 among different populations, using the frequency distributions of the following sub-clades: M285, P20, M377, M287, P287, P15*, P16, M286, M485, P303*, L497, U1*, M527, M406 and Page19. Origin and Migrations of Haplogroup G-M201 The first man to carry haplogroup G-M201 likely lived in southwestern Asia or the Caucasus between 46,000 and 54,000 years ago. Yunusbayev B, Metspalu M, Jrve M et al. Should any man with the P15 mutation test negative (ancestral) for any of these or vice versa, that finding would be the basis of a new G2a category. Men who belong to this group but are negative for all G2 subclades represent a small number of haplogroup G men. G-L91 would seem to encompass a significant proportion of men belonging to G. L91 is found so far in scattered parts of Europe and North Africa and in Armenia. G-M201 has also been found in Neolithic Anatolian sites such as Boncuklu dating back to 8300-7600 BCE, and Barcin dating back to 6419-6238 BCE. We attempted to localize the potential geographic origin of . Looking still more closely at the distribution of P303 sub-clades, some distinct patterns emerge in the network (Figure 4). The L141 mutation involves an insertion.[35]. The complexity is apparent in both the phylogenetic resolution and geographic patterning within hgs G and J2a. The naming of sub-clades is according to YCC nomenclature principles. Although the low frequency of hg G1-M285 makes it impractical to justify displaying a spatial frequency map, it is found (Supplementary Table S1) in the Near/Middle East including Anatolia, the Arabian Peninsula and Persian Gulf region, as well as Iran and the South Caucasus (mostly Armenians). Semino O, Magri C, Benuzzi G et al. Kaniewski D, Van Campo E, Van Lerberghe K et al. Y chromosomal heritage of Croatian population and its island isolates. Considering these issues, we acknowledge that the variance of the age estimates may be underestimated. Samples have been identified in England, Germany, Montenegro (Bosniak), Spain, Cyprus (Greek), Turkey, Armenia, Georgia, Lebanon, Syria and Kuwait. This video explains the migration route of Y-chromosome haplogroup G and the countries where it can be found today. PubMed Hum Genet 2004; 114: 127148. (Previously the name Haplogroup M was assigned to K2b1d. New York: Columbia University Press, 1987. Semino O, Santachiara-Benerecetti AS, Falaschi F, Cavalli-Sforza LL, Underhill PA : Ethiopians and Khoisan share the deepest clades of the human Y-chromosome phylogeny. [21] In a study of 936 Indians, haplogroup G made up less than 1% of the sample and was completely absent in the tested Northwestern Indian population. Y-chromosomal evidence of the cultural diffusion of agriculture in Southeast Europe. It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. The presence of hg G was first reported in Europe and Georgia5 and later described in additional populations of the Caucasus.6 Subsequently, several data sets containing hg G-related lineages have been presented in studies of different European populations7, 8, 9, 10 and so on, as well as studies involving several Middle Eastern and South Asian populations.4, 11, 12, 13, Hg G, together with J2 clades, has been associated with the spread of agriculture,5 especially in the European context.